Genetically modified microorganism, bioreactor, Silbersee water, harddrive, LED-screen
MicroCodex at Buitenplaats Kasteel Wijlre, 2025As Jane Bennett suggests in her 2010 book Vibrant Matter, earthworms, leaves, bacteria, metals, and plastic - all of these earthy materials form an “affective” archive, holding traces of human and nonhuman histories. The earth holds memory and remembers. The materials and intelligences that make up our ecosystems bear traces of different histories, forming an archive that has shaped the way we relate to them. This idea is both philosophical and tangible. Geologists read the earth’s strata to understand environmental shifts in deep time, while archaeologists uncover artifacts from ancient bogs. The earth stores memory as a dynamic archive, constantly in flux yet able to hold information through millennia.
The Silbersee in February 1990 - Photo by Rainer UnkelOne such record is the Silbersee in the East German town of Bitterfeld- Wolfen. The Silbersee is an artificial lake formed in a former open-air lignite mine. After all the lignite was extracted around 1930, the mine was gradually filled with industrial waste from local chemical factories until 1990. The toxic sludge pumped into the pit destroyed the existing ecosystem, but became fertile ground for a new microbiome that took it's place. A specific collection of microbes that adapted to thrive within the artificial bog now stands as a living archive of the ecological violence perpetratred within the chemical heart of Germany.
Harvesting sludge for sequencing at Helmholtz-Zentrum
für Umweltforschung GmbH - UFZ, 2025In MicroCodex, new memory is introduced into this archive. Microbes found within the lake’s troubled waters are genetically altered in the laboratories of Wageningen University to carry new memory. The data encoded within the microbe is the sentence “For every atom belonging to me as good belongs to you”, from the Walt Whitman poem Song of Myself. The poem resonates with the fundamental principle of universal connectivity and enmeshment, emphasizing that every element in the biological and ecological archive is inherently intertwined.
Synthetic DNA sequence encoding the text 'for every atom belonging to me as good belongs to you' from Walt Whitman's Song of Myself.In order to embed the sentence within the microbe’s genetic material, it was translated into the very same language that forms the building blocks of all living matter. DNA is expressed through nucleotides, which are represented in biology by the letters A, T, C, and G. Through a coding mechanism, the sentence is transformed into the nucleotide sequence below. This strain was subsequently synthesized, and inserted into the genetic material of the microbe.
ORIGINAL:
“For every atom belonging to me as good belongs to you”
DNA:
“CACGCGTTCTAGAGAACACCCTCGCGCCCTAGCTGCAGAACAACCTCACGTTCGTCAGAACAAGCGCCCGTACGTTCGTGCGCTCGGCCGTGCGCTAGAACCCACGTTAGAACATCCGCCAGAACAACCTATAGAACACTCGTTCGTTCGCAAGAACAAGCGCCCGTACGTTCGTGCGCTCTATAGAACCCACGTTAGAACCGCCGTTCTCC”
“For every atom belonging to me as good belongs to you”
DNA:
“CACGCGTTCTAGAGAACACCCTCGCGCCCTAGCTGCAGAACAACCTCACGTTCGTCAGAACAAGCGCCCGTACGTTCGTGCGCTCGGCCGTGCGCTAGAACCCACGTTAGAACATCCGCCAGAACAACCTATAGAACACTCGTTCGTTCGCAAGAACAAGCGCCCGTACGTTCGTGCGCTCTATAGAACCCACGTTAGAACCGCCGTTCTCC”
Visual representation of the MicroCodex synthetic DNA - image by Sarah de Roode, 2025This genetically modified microorganism is displayed within a sculptural bioreactor – a closed life-support system that will allow it to live and grow and reproduce throughout the duration of the exhibiton. With every new generation of microbes, genetic mutation might alter the sentence’s structure, meaning, or legibility. The words are reimagined by the metabolism of this microorganism, and by the toxic water it inhabits. Every two weeks, the DNA of the microbe is sequenced and the new mutations of the poem are added to the archive shown on the LED-display in the exhibition space.

Bioreactor within the sculpture at Buitenplaats Kasteel Wijlre, 2025
The microbial culture has been incubated in the microbiology lab of Wageningen University for some time prior to the exhibiton. Hence, a first few mutations have already been registered – among which a perculiar deletion within the middle part of the sentence.
After a few weeks the microbe responded:
“for every atom belongs to you”

LED-display showing the first mutations at Buitenplaats Kasteel Wijlre, 2025
Petri dish containing the genetically modified organism at WUR, 2025-----------------------------------------------
MicroCodex marks the first time a genetically modified organism is exhibited outside of a laboratory setting in the Netherlands. This feat of science, multi-disciplinary collaboration, and bureaucracy, could not have been possible without the help of the people mentioned below. I am grateful for the trust they have given me, their generousity of time and expertise, their patient teachings, and the energy they have put into the project.
-Research Advisors
Fred Walkow
Constanze Müller
-MDSE
Marko Grossmann
-Helmholtz-Zentrum für Umweltforschung GmbH - UFZ
Dr. Ivonne Nijenhuis
Dr. Carsten Vogt
Florian Tschernikl
-Wageningen University and Research
Dr. Raymond Staals
Sarah de Roode
Dianka Dees, MVF
Dr. Diana Machado de Sousa
Tom Schonewille
-Technical Assistance
Joost Plattel
-Curator
Lieneke Hulshof
MicroCodex has been made possible by the generous funding of the Mondriaan Fund, AFK fund, and DutchCulture. In order to exhibit MicroCodex, permits have been applied for and granted by the bureau of genetically modified organisms (Bureau GGO).