MicroCodex [edition], 2025
Synthetic DNA, modified medical ampoule, laser cut aluminum 

This glass ampoule holds the original synthetic DNA sequence designed for the MicroCodex project - the unmutated sentence from Walt Whitman’s Song of Myself:


“for every atom belonging to me, as good belongs to you”


Translated into the ATCG coding of DNA


“cacgcgttctagagaacaccctcgcgccctagctgcagaacaacctcacgttcgtcagaa
caagcgcccgtacgttcgtgcgctcggccgtgcgctagaacccacgttagaacatccgcc
agaacaacctatagaacactcgttcgttcgcaagaacaagcgcccgtacgttcgtgcgctc
tatagaacccacgttagaaccgccgttctcc”



In MicroCodex, this synthetic DNA is embedded within microbes from the East-German Silbersee. Living in a closed life-support system, the microbes mutate the words in ever new poetic forms. This edition sees the source code of the project suspended in glycerin - a preserved reference point against which future mutations are measured.

This work is made in an edition of 30 pieces. Please contact me via veldhuisstef@gmail.com when interested.